Skip Navigation

This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Danel, F.
Right arrow Articles by Livermore, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Danel, F.
Right arrow Articles by Livermore, D. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?

Journal of Antimicrobial Chemotherapy (1999) 43, 339-344
© 1999 The British Society for Antimicrobial Chemotherapy

Laboratory mutants of OXA-10 ß-lactamase giving ceftazidime resistance in Pseudomonas aeruginosa

Franck Danel*, Lucinda M. C. Hall and David M. Livermore{dagger}

Antibiotic Group, Department of Medical Microbiology, St Bartholomew's and the Royal London School of Medicine and Dentistry, Turner Street, London E1 2AD, UK


    Abstract
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several extended-spectrum ß-lactamases (ESBLs) belonging to molecular Class D have been described from Pseudomonas aeruginosa isolates collected in Turkey. Four of these, OXA-11, -14, -16 and -17, are derivatives of OXA-10 -lactamase. We tried to select similar mutants in vitro from OXA-10-producing transconjugants of P. aeruginosa, using a multistep method on ceftazidime-containing agars. Forty-four such mutants were obtained; all had increased resistance to ceftriaxone, cefsulodin, cefepime, cefpirome, latamoxef, aztreonam and, especially, ceftazidime whereas MICs of piperacillin, carbenicillin, cefotaxime, cefoperazone and carbapenems were little altered. Genes related to bla OXA-10 were sequenced from five mutants. One mutant enzyme had aspartate instead of glycine at position 157, and corresponded exactly to natural OXA-14 ß-lactamase. Another mutant strain appeared to have both OXA-14 and a new pI 6.2 enzyme, designated OXA-M102, with serine instead of alanine at position 124 and aspartate instead of glycine at position 157. This latter variant resembled natural OXA-16 enzyme, which has threonine at position 124 and aspartate at position 157. The remaining three mutant enzymes differed from any so far found in wild-type isolates. Two had leucine replacing tryptophan at position 154 (this enzyme was named OXA-M101) while the third (OXA-M103) had a pI of 7.6, and had lysine instead of asparagine at position 143. A different mutation at this position was previously found in OXA-11, a wild-type OXA-10 mutant. Thus, some of the ESBL mutants selected (OXA-14 and OXA-M102) correspond exactly or almost exactly to ESBLs found in wild-types, whereas others (OXA-M101 and OXA-M103) were totally new.


    Introduction
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Studies on ceftazidime-resistant Pseudomonas aeruginosa isolates collected at Hacettepe Hospital, Ankara, Turkey revealed four mutants of OXA-10 (PSE-2) ß-lactamase with enhanced ability to give cephalosporin resistance as compared with the parent enzyme. 1,2,3,4 These extended-spectrum ß-lactamase (ESBL) mutants comprise OXA-11, -14, -16 and -17. OXA-11, -14 and -16 enzymes all have aspartate replacing glycine at position 157 (Table I) and give high-level ceftazidime resistance;1,2,3, OXA-17 has serine instead of asparagine at position 73, and predominantly confers resistance to cefotaxime, not ceftazidime. 4


View this table:
[in this window]
[in a new window]
 
Table I. Extended-spectrum ß-lactamases derived from OXA-10 in nature and in the laboratory
 
The evolution of ESBL activity in OXA-10 mutants parallels that seen in the TEM and SHV families of ß-lactamases.5,6 In these latter families, it proved possible to select ESBL mutants in vitro, and these resemble or correspond exactly to ESBLs found in wild-type isolates. 7,8,9,10 In the present study we similarly aimed to select and sequence ESBL mutants of OXA-10 enzyme, using single-step and multistep procedures.


    Materials and methods
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Bacterial strains and plasmids

P. aeruginosa PU21 ilv leu Strr Rifr transconjugants11 with plasmids R151 5,12,13 and pMLH511,14 were used as reference producers of OXA-10 ß-lactamase. PU21 transconjugants with plasmids pMLH52, pMLH53 and pMLH57 were used as reference producers of OXA-11, -14 and -16 ß-lactamases, respectively. 1,2,3 P. aeruginosa M2297-con15 was used as a representative derepressed producer of AmpC ß-lactamase. The OXA ß-lactamases were used as pI markers for isoelectric focusing, together with AmpC (pI 9.2), SHV-2 (pI 7.6) and SHV-3 (pI 7.0) enzymes from Escherichia coli J53-2 and its transconjugants. Strain PU21 and its ciprofloxacin-resistant mutant, selected by the method of Tenney et al.,16 were used as recipients in conjugation. E. coli NCTC 10418 was used as a sensitive indicator organism in bioassays.

Antibiotics

Antimicrobials tested were: ciprofloxacin (Bayer, Newbury, UK), aztreonam and cefepime (Bristol Myers Squibb, Syracuse, NY, USA), cefsulodin (Novartis, Basel, Switzerland), ceftazidime (Glaxo-Wellcome, Stevenage, UK), piperacillin and tazobactam (Wyeth-Lederle, Taplow, UK), cephalothin and latamoxef (Lilly, Basingstoke, UK), imipenem (Merck Sharp and Dohme, Hoddesdon, UK), ceftriaxone (Roche, Welwyn Garden City, UK), Ro 48-1256 (Roche, Basel, Switzerland), cefotaxime and cefpirome (Roussel, Uxbridge, UK), carbenicillin and clavulanate (SmithKline Beecham, Brentford, UK) and meropenem (Zeneca, Macclesfield, UK).

Single-step selection of ceftazidime-resistant mutants

Cultures of P. aeruginosa PU21(R151) or PU21(pMLH51) were grown overnight in Nutrient Broth No. 2 (Unipath, Basingstoke, UK) to densities of 3 x 109 cfu/mL, then 0.1 mL amounts were spread on Nutrient Agar (Unipath) containing ceftazidime at 32, 64 or 128 mg/L. Colonies that grew during overnight incubation at 37°C were subcultured with the same concentration of ceftazidime, on Nutrient Agar containing ceftazidime 32 mg/L, with or without Ro 48-1256 at 8 mg/L as an inhibitor of AmpC ß-lactamases. 17 Cultures that remained resistant to ceftazidime in the presence of Ro 48-1256 were retained.

Multistep selection of ceftazidime-resistant mutants

P. aeruginosa PU21(R151) and PU21(pMLH51) cultures were grown overnight in Nutrient Broth, then swabbed on Nutrient Agar containing ceftazidime at 0.5 x MIC (1 mg/L) and incubated at 37°C for 24 h. The growth was resuspended in 2 mL of 10 mM phosphate buffer pH 7.0, then swabbed on nutrient agar containing twice the previous concentration of ceftazidime.16 This process was repeated daily, with the ceftazidime concentration being increased stepwise to 512 mg/L. Once the ceftazidime concentration exceeded 32 mg/L, a second plate was half-swabbed and half-streaked at each cycle, aiming to yield single colonies. Three such colonies per plate were subcultured on to nutrient agar with the same ceftazidime concentration. After overnight growth, these were tested for their ability to grow on nutrient agar containing ceftazidime 32 mg/L with or without Ro 48-1256, 8 mg/L. Mutants where resistance was not reversed by Ro 48-1256 were retained.

Susceptibility tests

MICs were determined on DST agar (Unipath) with inocula of 104 cfu per spot, as previously described.1

Plasmid transfer to P. aeruginosa PU21

Plasmids were transferred from P. aeruginosa PU21 transconjugants to the ciprofloxacin-resistant mutant P. aeruginosa PU21 Cipr by overnight plate-mating of logarithmic phase cells on drug-free DST agar. The cells were then harvested and spread on the same medium containing ceftazidime 25 or 50 mg/L, plus ciprofloxacin 20 mg/L.16

Isoelectric focusing

ß-Lactamases from isolates and transconjugants were characterized by isoelectric focusing of ultrasonic extracts prepared from overnight nutrient agar cultures. 18

Sequencing of ß-lactamase genes

The sequences of OXA-10-related genes were determined from DNA fragments amplified by PCR with primers ABD1 (TATCGCGTGTCTTTCGAGTA) and 5' biotin-labelled ABD4 (TTAGCCACCAATGATGCCC), using the method described previously. 1,2 The strands of the PCR product were separated using paramagnetic beads conjugated with streptavidin (Dynabeads M-280 Streptavidin, Dynal, New Ferry, UK), and were used as templates for sequencing by chain termination, with primers ABD1 (see above), ABD2 (CGGAAAGCCAAGAGCC) and ABD3 (AAATTGTCAGCATCTA). Methods were as described by Hall et al. 1

Bioassays of ß-lactamase activity

Crude ß-lactamase extracts were prepared by sonication of cells harvested from an overnight growth on a Nutrient Agar plate19 and were mixed 1:1 with 40 mg/L ceftazidime in 10 mM phosphate buffer pH 7.0. After incubation at 37°C for 1 h, these mixtures were transferred to 7 mm diameter wells cut in a bioassay plate (20 cm x 20 cm) containing Mueller-Hinton agar (Unipath) seeded with E. coli NCTC 10418 at 107 cfu/mL. The plate was incubated for 18 h at 37°C, and the inhibition zones for the enzyme-treated antibiotic were compared with those given by untreated drug.


    Results
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Single-step selection of ceftazidime resistance

Resistant mutants of P. aeruginosa PU21(R151) or PU21(pMLH51) were selected on agar containing ceftazidime at 32 mg/L at a frequency of 8.6 x 10–8, whereas no single-step mutants were selected at higher ceftazidime concentrations. Thirty such mutant colonies and, as controls, P. aeruginosa PU21(R151), PU21(pMLH51), PU21(pMLH52), PU21(pMLH53) and M2297-con (AmpC derepressed) were subcultured on agar containing ceftazidime 32 mg/L, with or without Ro 48-1256, 8 mg/L. The mutant colonies, and M2297-con, were resistant to ceftazidime in the absence of the inhibitor, but sensitive in its presence, whereas producers of OXA-11 and -14 enzymes grew irrespective of the presence of inhibitor, and the OXA-10 producers were susceptible to ceftazidime. Since Ro 48-1256 is a specific inhibitor of AmpC enzymes,17 it was concluded that the method had selected AmpC hyperproducers, not OXA-10 mutants.

Multistep selection of ceftazidime resistance

P. aeruginosa PU21 transconjugants with plasmids R151 or pMLH51 were subcultured on plates with doubling concentrations of ceftazidime from 1 to 512 mg/L. Selection from PU21(pMLH51) was done in duplicate, to see if similar mutations were obtained on each occasion. Eight to twelve colonies selected at each ceftazidime concentrations from 32 mg/L upwards were subcultured on ceftazidime 32 mg/L with or without the Ro 48-1256 at 8 mg/L. Mutants selected with <32 mg/L ceftazidime consistently became sensitive to this cephalosporin in the presence of Ro 48-1256. However, only half of the PU21(R151) mutants selected with ceftazidime at 64 mg/L became sensitive in the presence of Ro 48-1256, and none of those selected with higher ceftazidime concentrations became sensitive. Similarly, of the mutants selected from PU21(pMLH51) with ceftazidime at 64 mg/L, only one became sensitive in the presence of Ro 48-1256 and all those selected with higher ceftazidime concentrations remained resistant in the presence of Ro 48-1256.

Mutants of PU21(R151) were designated the `A series' . Mutants of PU21(pMLH51) were selected in two separate experiments; those from the first experiment are termed the `B series' ; those from the second experiment, the `C series'. Mutants were further designated by the ceftazidime concentration at which they were selected and were given a sequential number as an individual identifier. Thus, 64B1 was a mutant of PU21(pMLH51) and was selected with 64 mg/L ceftazidime.

No mutants resistant to ceftazidime plus Ro 48-1256 were selected from strain PU21, which was tested as a control.

Susceptibility of ceftazidime-selected mutants

Forty-four mutants resistant to the combination of ceftazidime (32 mg/L) and Ro 48-1256 (8 mg/L) were subjected to susceptibility testing. The resistance profiles of most mutants were very similar, irrespective of the parent strain, the selection series and the ceftazidime concentration used for selection (Table II).


View this table:
[in this window]
[in a new window]
 
Table II. ß-Lactam MICs for ceftazidime-resistant mutants of P. aeruginosa PU21 producing OXA-10 ß-lactamase, and for reference comparators
 
The mutants had increased resistance to ceftriaxone, cefsulodin, cefepime, cefpirome, latamoxef, aztreonam and, especially, ceftazidime. On the other hand they were no more resistant than their parent strains to piperacillin, cefotaxime and cefoperazone and tended to be four-fold less resistant to carbenicillin. Both the parents and the mutants were fully susceptible to carbapenems. MICs of piperacillin, carbenicillin and ceftazidime were reduced no more than two-fold by clavulanate or tazobactam, 4 mg/L.

The MIC profiles of all the mutants were similar to those for PU21 transconjugants with wild-type OXA-11 and -14 enzymes, whereas overproducers of AmpC, as represented by M2297-con, were much less resistant to ceftazidime but much more resistant to cefotaxime.

Conjugative transfer of mutant OXA-10 ß-lactamases

Resistance was transferred from several ceftazidime-selected mutants of PU21(R151) to PU21 Cipr, as a control to determine whether these mutants had other mechanisms of resistance besides the ß-lactamase variants. The transconjugants showed similar resistance profiles to the original mutants (Table II), confirming that the resistance was attributable to the plasmid and its encoded ß-lactamase.

Isoelectric focusing of the OXA-10 ß-lactamase mutants

ß-Lactamase extracts from seven mutants were characterized by isoelectric focusing. Among the PU21(R151) derivatives, organisms 512A1 and 512A2 produced pI 6.1 ß-lactamases and 64A had a pI 6.2 enzyme. Among the mutants selected from P. aeruginosa PU21(pMLH51), organisms 128B and 512B both produced ß-lactamases with pIs of 6.2, whereas 64C1 produced an enzyme with a pI of 6.1, and 64C2 produced a pI 7.6 ß-lactamase.

Sequencing of the mutant blaOXA-10 genes

Sequences were determined for blaOXA-10 derivatives from mutants 64A, 512A, 128B, 512B and 64C2. These were selected as possessing quantitatively different resistance profiles, as having ß-lactamases with different pIs and as having been selected at low and high ceftazidime concentrations. Mutations were consistently found in bla OXA-10; these are shown in Table I together with the predicted amino acid sequences. Mutants 64A and 512A both possessed an OXA-10 derivative with leucine instead of tryptophan at position 154; this mutant enzyme was designated OXA-M101. Mutant 128B possessed an ESBL corresponding exactly to OXA-14,2 with aspartate instead of glycine at position 157; mutant 512B also possessed OXA-14, but additionally had another variant, dubbed OXA-M102, corresponding to OXA-14 but also with serine instead of alanine at position 124. Finally, the ß-lactamase from mutant 64C2 had lysine instead of asparagine at position 143 and was called OXA-M103.

Ceftazidime hydrolysis

Bioassay was performed as a sensitive method for detecting ceftazidime hydrolysis. Zone diameters after incubation of enzyme and ceftazidime 40 mg/L for 1 h at 37°C were as follows: control OXA-10 from PU21(pMLH51), 2.8 cm; OXA-11 from PU21(pMLH52), 2.5 cm; OXA-14 from PU21(pMLH53), 2.5 cm; OXA-M101 from mutants 64A and 512A, 1.3 cm; OXA-14 from 128B, 0.7 cm; OXA-14/OXA-M102 mixture from 512B, 0.7 cm; OXA-M103 from mutant 64C2, 2.6 cm. Ceftazidime 20 mg/L, without enzyme treatment, gave a zone of 2.9 cm. It is concluded that the present mutants, like OXA-11 and -14, but unlike OXA-10, had ESBL activity.


    Discussion
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
Several ESBL mutants of OXA-10 have been found in ceftazidime-resistant P. aeruginosa isolates,1,2,3,4 and attempts were made to select analogous mutants in vitro. OXA-10 ß-lactamase itself does not affect the sensitivity of P. aeruginosa to ceftazidime. 1

Initial attempts to select OXA-10 mutants were by a single-step method, as previously used to select extended-spectrum laboratory mutants of TEM and SHV enzymes. 7,8,9,10 These experiments were unsuccessful, and it was concluded that the frequency of selection was below the value of 3 x 108 observed in the TEM and SHV families, and for PSE-4.8 ESBL mutants of OXA-10 were, however, obtained by a multistep method, which was applied to P. aeruginosa PU21 transconjugants with plasmids pMLH51 or R151. Selection with ceftazidime at >=64 mg/L proved critical: at lower concentrations only AmpC-derepressed mutants were found, but at ceftazidime concentrations of 128, 256 and 512 mg/L only ESBL mutants of OXA-10 were selected. With ceftazidime at 64 mg/L, both mutant types were found. A total of 44 mutants were studied. None of these showed synergy between Ro 48-1256 and ceftazidime, contraindicating AmpC hyperproduction; moreover, resistance co-transferred with OXA-10-coding plasmids, confirming that other resistance mechanisms were not involved.

One mutant, 128B, produced an OXA-14 ß-lactamase identical to that found in a wild-type isolate.2 Another mutant, OXA-M102, had aspartate instead of glycine at position 157 (as did OXA-14), but additionally had serine instead of alanine at position 124. OXA-M102 thus corresponded to the OXA-16 enzyme, except that the latter had threonine rather than serine at position 124.3 Serine and threonine are similar amino acids, the only difference being that threonine has an extra methylene group in its carbon chain (threonine is CH2OH·CH2·CHNH2·COOH, whereas serine is CH2OH·CHNH2·COOH). The other ESBL mutants selected had single mutations that differed from any so far found in naturally occurring mutants in wild-type isolates: OXA-M101 had leucine instead of the tryptophan at position 154 and OXA-M103 had lysine instead of asparagine at position 143. Position 143 is mutated, albeit differently, in the naturally occurring mutant OXA-11, suggesting that the residue at this site plays a critical role in catalysis. The pI of OXA-M103 was very high compared with that of OXA-10 (the former was 7.6 and the latter 6.1) and can be explained by the introduction of a basic amino acid. The positive charge from such an amino acid might alter the charge on the surface of the protein. Such a charge might affect monomer/dimer partition in OXA-10 variants and disproportionately alter pI.

The OXA-10 mutants all had increased resistance to ceftriaxone, cefsulodin, cefepime, cefpirome, latamoxef and, especially, ceftazidime. This pattern was also found in OXA-11, -14 and -16 from wild-type isolates.1,2,3,4 Ceftazidime resistance correlated with hydrolytic activity, as demonstrated by bioassay. Resistance to cefotaxime and aztreonam was more variable: and may have reflected activity differences among the ESBL mutants, or variation in the quantity of enzyme produced. It should be emphasized that present selections were all with ceftazidime, and other variants might be selected by other third- or fourth-generation cephalosporins. In this context we note that one wild-type derivative of OXA-10, OXA-17 (Table I), is predominantly a cefotaximase, giving minimal protection against ceftazidime.


    Acknowledgments
 
We are very grateful to Brigid Duke for skilful technical assistance.


    Notes
 
* Present address: F. Hoffmann-La Roche Ltd, Pharmaceuticals Division, Pharma Research Preclinical Infectious Disease, CH-4070 Basel, Switzerland. Tel: +41-61-6880537; Fax: +41-61-6882729; E-mail: franck.danel{at}roche.com Back

{dagger} Present address: Antibiotic Reference Unit, Laboratory of Hospital Infection, Central Public Health Laboratory, 61 Colindale Avenue, London NW9 5HT, UK. Back


    References
 Top
 Abstract
 Introduction
 Materials and methods
 Results
 Discussion
 References
 
1 . Hall, L. M. C., Livermore, D. M., Gur, D., Akova, M. & Akalin, H. E. (1993). OXA-11, an extended-spectrum variant of OXA-10 (PSE-2) ß -lactamase from Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 37, 1637–44.[Abstract/Free Full Text]

2 . Danel, F., Hall, L. M. C., Gur, D. & Livermore, D. M. (1995). OXA-14, another extended-spectrum variant of OXA-10 (PSE-2) ß - lactamase from Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 39, 1881–4.[Abstract]

3 . Danel, F., Hall, L. M. C., Gur, D. & Livermore, D. M. (1998). OXA-16, a further extended-spectrum variant of OXA-10 ß -lactamase, from two Pseudomonas aeruginosa isolates. Antimicrobial Agents and Chemotherapy 42, 3117–22.[Abstract/Free Full Text]

4 . Danel, F., Hall, L. M. C., Gur, D. & Livermore, D. M. (1996). Multiple secondary ß-lactamases, including a new OXA-10 mutant, in two Turkish P. aeruginosa isolates. In Abstracts of the European Congress of Chemotherapy , Abstract T119. Panthenon Publishing, Carnforth.

5 . Livermore, D. M. (1995). ß -Lactamases in laboratory and clinical resistance. Clinical Microbiology Reviews 8, 557–84.[Abstract]

6 . Jacoby, G. A. (1994). Genetics of extended-spectrum ß-lactamases. European Journal of Clinical Microbiology and Infectious Diseases 13, Suppl., S2–11.

7 . Gutmann, L., Kitzis, M. D., Billot-Klein, D., Goldstein, F., Tran Van Nhieu, G., Lu, T. et al. (1988). Plasmid-mediated ß -lactamase (TEM-7) involved in resistance to ceftazidime and aztreonam. Review of Infectious Diseases 10, 860–6.[Web of Science][Medline]

8 . Payne, D. J., Marriott, M. S. & Amyes, S. G. (1989). Mutants of the TEM-1 ß-lactamase conferring resistance to ceftazidime. Journal of Antimicrobial Chemotherapy24 , 103–10.[Abstract/Free Full Text]

9 . Sougakoff, W., Goussard, S., Gerbaud, G. & Courvalin, P. (1988). Plasmid-mediated resistance to third-generation cephalosporins caused by point mutations in TEM-type penicillinase genes. Reviews of Infectious Diseases 10, 879–84.[Web of Science][Medline]

10 . Kliebe, C., Nies, B. A., Meyer, J. F., Tolxdorff-Neutzling, R. M. & Wiedemann, B. (1985). Evolution of plasmid-coded resistance to broad-spectrum cephalosporins. Antimicrobial Agents and Chemotherapy 28, 302–7.[Abstract/Free Full Text]

11 . Jacoby, G. A. (1974). Properties of an R plasmid in Pseudomonas aeruginosa producing amikacin (BB-K8), butirosin, kanamycin, tobramycin, and sisomicin resistance. Antimicrobial Agents and Chemotherapy 6, 807–10.

12 . Bryan, L. E., Shahrabadi, M. S. & van den Elzen, H. M. (1974). Gentamicin resistance in Pseudomonas aeruginosa : R-factor- mediated resistance. Antimicrobial Agents and Chemotherapy 6, 191–9.[Abstract/Free Full Text]

13 . Huovinen, P., Huovinen, S. & Jacoby, G. A. (1988). Sequence of PSE-2 ß-lactamase. Antimicrobial Agents and Chemotherapy 32, 134–6.[Abstract/Free Full Text]

14 . Livermore, D. M., Maskell, J. P. & Williams, J. D. (1984). Detection of PSE-2 ß-lactamase in enterobacteria. Antimicrobial Agents and Chemotherapy 25,268 –72.[Abstract/Free Full Text]

15 . Livermore, D. M. (1992). Interplay of impermeability and chromosomal ß-lactamase activity in imipenem-resistant Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 36, 2046–8.[Abstract/Free Full Text]

16 . Tenney, J. H., Maack, R. W. & Chippendale, G. R. (1983). Rapid selection of organisms with increasing resistance on subinhibitory concentrations of norfloxacin in agar. Antimicrobial Agents and Chemotherapy 23, 188–9.[Abstract/Free Full Text]

17 . Livermore, D. M. & Chen, H. Y. (1997). Potentiation of ß-lactams against Pseudomonas aeruginosa strains by Ro 48-1256, a bridged monobactam inhibitor of AmpC ß-lactamases. Journal of Antimicrobial Chemotherapy 40, 335–43.[Abstract/Free Full Text]

18 . Matthew, A., Harris, A. M., Marshall, M. J. & Ross, G. W. (1975). The use of analytical isoelectric focusing for detection and identification of ß-lactamases. Journal of General Microbiology 88, 169–78.[Medline]

19 . Danel, F. (1997). Extended-spectrum ß-lactamases from Pseudomonas aeruginosa isolates collected in Turkey. PhD thesis, University of London.

Received 19 May 1998; returned 31 July 1998; revised 18 September 1998; accepted 29 September 1998


Add to CiteULike CiteULike   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us    What's this?


This article has been cited by other articles:


Home page
Antimicrob. Agents Chemother.Home page
A. Novais, R. Canton, T. M. Coque, A. Moya, F. Baquero, and J. C. Galan
Mutational Events in Cefotaximase Extended-Spectrum {beta}-Lactamases of the CTX-M-1 Cluster Involved in Ceftazidime Resistance
Antimicrob. Agents Chemother., July 1, 2008; 52(7): 2377 - 2382.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
K. L. Driffield, J. M. Bostock, K. Miller, A. J. O'Neill, J. K. Hobbs, and I. Chopra
Evolution of extended-spectrum {beta}-lactamases in a MutS-deficient Pseudomonas aeruginosa hypermutator
J. Antimicrob. Chemother., October 1, 2006; 58(4): 905 - 907.
[Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. Mushtaq, Y. Ge, and D. M. Livermore
Doripenem versus Pseudomonas aeruginosa In Vitro: Activity against Characterized Isolates, Mutants, and Transconjugants and Resistance Selection Potential
Antimicrob. Agents Chemother., August 1, 2004; 48(8): 3086 - 3092.
[Abstract] [Full Text] [PDF]


Home page
J Antimicrob ChemotherHome page
D. Aubert, L. Poirel, A. Ben Ali, F. W. Goldstein, and P. Nordmann
OXA-35 is an OXA-10-related {beta}-lactamase from Pseudomonas aeruginosa
J. Antimicrob. Chemother., November 1, 2001; 48(5): 717 - 721.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
L. Poirel, D. Girlich, T. Naas, and P. Nordmann
OXA-28, an Extended-Spectrum Variant of OXA-10 {beta}-Lactamase from Pseudomonas aeruginosa and Its Plasmid- and Integron-Located Gene
Antimicrob. Agents Chemother., February 1, 2001; 45(2): 447 - 453.
[Abstract] [Full Text]


Home page
Antimicrob. Agents Chemother.Home page
F. Danel, L. M. C. Hall, B. Duke, D. Gur, and D. M. Livermore
OXA-17, a Further Extended-Spectrum Variant of OXA-10 beta -Lactamase, Isolated from Pseudomonas aeruginosa
Antimicrob. Agents Chemother., June 1, 1999; 43(6): 1362 - 1366.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow FREE Full Text (PDF) Freely available
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Add to My Personal Archive
Right arrow Download to citation manager
Right arrow Search for citing articles in:
ISI Web of Science (15)
Right arrowRequest Permissions
Right arrow Disclaimer
Google Scholar
Right arrow Articles by Danel, F.
Right arrow Articles by Livermore, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Danel, F.
Right arrow Articles by Livermore, D. M.
Social Bookmarking
 Add to CiteULike   Add to Connotea   Add to Del.icio.us  
What's this?