Journal of Antimicrobial Chemotherapy (1999) 43, 5-14
© 1999 The British Society for Antimicrobial Chemotherapy
Host range of the ermF rRNA methylase gene in bacteria of human and animal origin
a Department of Pathobiology, University of Washington, Seattle, WA, USA; b Institute of Animal Science and Animal Behavior (FAL), Celle, Germany
| Abstract |
|---|
|
|
|---|
We screened 183 different clinical anaerobic and aerobic bacteria isolated from humans and other animals for the presence of the ermF gene using a polymerase chain reaction (PCR) assay. The ermF gene was detected in 107 (58%) clinical isolates, including 42 (61%) of 69 Gram-positive bacteria and 65 (57%) of 114 Gram-negative bacteria. Twenty-five ATCC isolates were also tested; 20 (80%) carried the ermF gene. The gene products from the ermF PCR from four isolates were sequenced and showed 9599% nucleotide homology with the ermF gene and 9899% amino acid homology with the gene product. Eleven (58%) of the 19 Gram-negative donors tested were able to transfer the ermF gene. All nine (100%) of the Gram-positive donors tested transferred the ermF gene, using either Enterococcus faecalis or Haemophilus influenzae as the recipients.
| Introduction |
|---|
|
|
|---|
The overall consumption of macrolides is expected to increase as the use of new-generation macrolides becomes more widespread. 1 ,2 ,3 This may increase the selective pressure on bacterial populations, which could result in an increase in macrolide-resistant bacteria. Erythromycin and other macrolides bind to the prokaryotic 50S ribosomal subunit and stimulate the dissociation of peptidyl tRNA from the ribosome during the elongation phase, pre venting protein synthesis. 4 One of the most common mechanisms of resistance results from the action of rRNA methylases, which post-transcriptionally methylate a single adenine residue in the peptidyltransferase region of 23S rRNA. 5 This modification decreases the affinity of the 50S ribosomal subunit for macrolidelincosamidestreptogramin (MLS) antimicrobials, giving the MLS phenotype. 5 ,6 Although these three types of antibiotic are chemically distinct, they are thought to have an over lapping binding site. 6 The rRNA methylases are encoded by erythromycin ribosome methylation (erm) genes. Over 30 erm genes have been described from a variety of species; all methylate the same adenine residue and have the same MLS phenotype.7
The ermF gene was first described in anaerobic colonic Bacteroides spp.8 Three highly related genes, ermF, ermFS and ermFU, have now been described 9 ,10 and are part of the ermF group. Before the present study was undertaken, the ermF group was thought to have a relatively narrow host range, consisting of Bacteroides ovatus, Bacteroides fragilis, Bacteroides thetaiotaomicron, bovine strepto coccal species and, more recently, Treponema denticola, an anaerobic spirochaete thought to play a role in periodontal disease.8 ,11 ,12 ,13 The goal of this study was to develop a specific ermF PCR assay and use it to determine the ermF host range by examining a large, diverse groups of bacteria isolated from humans and other animals. We also wanted to determine if the ermF gene was associated with mobile elements in diverse species, so the presence of DNA upstream and downstream of the structural ermF gene, found in the large conjugative bacteroides element, was also studied. 9 ,14
| Materials and methods |
|---|
|
|
|---|
Source of isolates
One hundred and eighty-three clinical isolates, representing aerobes and anaerobes from humans and other animals, were used in this study. 12 ,15 ,16 ,17 In addition, 25 oral and urogenital strains from the American Type Culture Collection (ATCC) were included in the study (Tables I ,II ,III). For most of these, breakpoints have not been established, thus making it difficult to determine whether these isolates were resistant or susceptible. Most of the Bacteroides, Fusobacterium, Veillonella, Clostridium, Haemophilus, Lactobacillus, Staphylococcus and Streptococcus spp. were able to grow on media supplemented with either erythromycin and/or clindamycin. The sensitivity of Staphylococcus, Streptococcus and Actinobacillus spp. was tested; all organisms were resistant. 12 ,16 Others were not tested.
|
|
|
Proteinase K treatment
Isolates and transconjugants were treated with proteinase K as previously described18 and used as the source of the template for the polymerase
chain reaction (PCR) assays.
The proteinase K treatment was performed as follows: bacteria were suspended in a solution
containing 0.1 M Tris pH 8.5, 0.05% Tween 20 and 0.05 mg/mL proteinase K in 100
µL of sterile distilled water; incubated at 60°C for
6 h; boiled for 10 min then
aliquoted and frozen at 20°C. No proteinase K-treated sample was used more than
three times, since repeated freezing and thawing degrades the DNA samples (authors
unpublished observations).
PCR primers for the ermF gene
The ermF PCR described in our previous study was for the 1000 base pair (bp) ORF1 region, which has no known function and is directly upstream of the functional gene ermF (ORF2). 9 ,13 We decided that for this study we needed a new assay for the structural gene. The GenBank sequence of ermF covers 2080 bp and includes the structural ermF gene consisting of 798 bp starting at base 1203 and ending at base 2000. 8 ,9 The PCR primers used in the study were F1 (5'CGGGTCAGCACTTTACTATTG3' starting at base 1235) and F2 (5'GGACCTACCTCATAGACA AG 3', the antisense of the sequence ending at base 1700). The expected size of the PCR fragment was 466 bp.
PCR for the ermF gene
Each 100 µL reaction mixture contained 2 U of Taq poly merase (Boehringer Mannheim, Indianapolis, IN, USA) 200 µM deoxynucleoside tri phosphate, 13 PCR buffer I (1.5 mM MgCl2) and 100 ng of each primer. Ten to forty nanograms of DNA, or 12 µL of proteinase K-treated bacteria, were used as DNA template. The PCR conditions were as follows: denaturing at 94°C for 30 s; annealing at 50°C for 30 s; and elongation at 72°C for 2 min. The cycle was repeated 35 times. The plasmid pBF4, 19 containing cloned ermF, or water were used as a positive and a negative control, respectively. The PCR products were dried in a lyophilizer, resuspended in 10 µL of sterile H2O, run on 1.5% agarose gel and stained with ethidium bromide. Southern blots of these gels were made and hybridized with labelled ermF plasmid probes to confirm PCR product.
PCR primers and conditions for the ermA, ermB and ermC genes
AF (5'CTTCGATAGTTTATTAATATTAGT3') and AR (5'TCTAAAAAGCATGTAAAAGAA3'); BF (5'AGTAACGGTACTTAAATTGTTTAC3') and BR (5'GAAAAGGTACTCAACCAAATA3'); CF (5'GCTAATATTGTTTAAATCGTCAAT3') and CR (5'TCAAAACATAATATAGATAAA3') have previously been described. 20 The PCR conditions for ermB were the same as the ermF PCR. The PCR assay for ermA used denaturing at 94°Cfor 30 s, annealing at 48°C for 1 min, and elongation at 72°C for 2 min; the assay for ermC used denaturing at 94°C for 30 s, annealing at 43°C for 1 min, and elongation at 72°C for 2 min.
PCR primers and conditions for the ermF ORF1 and rteA/B genes
The oligonucleotide primers for the ORF1 region of the ermF gene, immediately upstream of the functional ermF gene, and the PCR conditions were the same as previously described (606 bp product). 13 The primers for the rteA/B genes, which are thought to be involved in regulation of transfer, 14 were rteA (5'GGCAATGAAGCCGTCATGC3') and rteA/B (5'GCTACCAGCCTTA TCCGG3'), and the expected product was 745 bp (see Figure). The PCR conditions for rteA/B were denaturing at 96°C for 30 s, annealing at 46°C for 1 min, and elongation at 72°C for 2 min for 35 cycles.
|
Plasmids
The plasmids carrying cloned ermA, ermB, ermC, ermF and ermQ were pEM9592, 21 pJIR229, 22 pBR328:33RV, 23 pBF4 8 and pJIR745, 21 respectively, and have all been previously described.
Hybridization
Plasmids pEM9592, pJIR229, pBR328:33RV, pBF4 and pJIR745 were labelled using the non-radioactive Genius kit plasmid labelling kit from Boehringer Mannheim according to the manufacturer's instructions. The labelled plasmids were used for hybridization with Southern blots of the appropriate PCR product. The hybridization and washes were done at 68°C according to the manufacturer's instructions. Detection was done with the CDP Star detection kit from Boehringer Mannheim at a concentration of 1:1000, as described by the manufacturer.
Sequencing
The ermF PCR products from Gram-positive Streptococcus dysgalactiae, anaerobic Gram-positive Clostridium butyricum, Gram-negative Actinobacillus actinomycetemcomitans and anaerobic Gram-negative Selenomonas dianae were sequenced separately using primers ermF1 and ermF2. A Taq DyeDeoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) was used for PCR amplification; the PCR products were filtered through Nuclean D50 filters (Kodak, Rochester, NY, USA) and then read on a model 373A sequencer (Applied Biosystems).13 The two sequences of each isolate were overlapped and aligned, then compared with the known GenBank sequence of ermF (accession number M14730) using Genetics Computer Group software (University of Wisconsin, Madison, WI, USA). The putative amino acid sequences were determined from the DNA sequences and also compared.
Mating experiments
Enterococcus faecalis JH2-2 and Haemophilus influenzae Rd8 were used as recipients in the mating experiments. 24 ,25 Enterococcus faecalis had been previously made chromosomally resistant to fusidic acid (25 mg/L) and rifampin (25 mg/L).25 The H. influenzae Rd8 had been previously made chromosomally resistant to streptomycin (250 mg/L), rifampicin (10 mg/L) and fusidic acid (25 mg/L). 24 Aerobes used in the mating were grown on brain-heart infusion (BHI) agar (Difco Laboratories, Detroit, MI, USA) at 36.5°C with 5% CO2. Anaerobes used were grown on brucella base blood agar (Difco) supplemented with 5% sheep blood, 5 mg/L haem and 0.05 mg/L vitamin K under anaerobic conditions (5% CO2, 10% H2 and 85% N2) at 36.5°C. For optimal conditions, the donor:recipient ratio was 1:1 for aerobic donors or 5:1 for anaerobic donors. The mating mixture was plated on agar plates, and incubated at 36.5°C in a CO2 incubator for 24 h for aerobic donors or in anaerobic jars for 48 h for anaerobic donors. For matings with anaerobic donors, serial dilutions of the mating mixture were plated on BHI plates supplemented with 10 mg/L erythromycin and incubated in CO2 as previously described. 13 Double selective markers were needed for aerobic matings, which were plated on BHI plates supplemented with 25 mg/L rifampicin plus 10 mg/L erythromycin for selection of transconjugants. All E. faecalis transconjugants were probed with a chromosomal DNA probe specific for JH2-2, as previously described.13 Presence of the ermF gene was confirmed by PCR and Southern blot hybridization.
| Results |
|---|
|
|
|---|
The specificity and sensitivity of the ermF PCR assay
The ermF cloned plasmid pBF4, when used as the template in the PCR assay, gave the product of the expected size (466 bp). The labelled plasmid ermF probe hybridized with the Southern blot of the PCR product (data not shown). When ermA, ermB, ermC and ermQ genes were used as templates, no PCR product was produced and the labelled pBF4 plasmid probe did not hybridize with the blot (data not shown). S. dysgalactiae, Streptococcus agalactiae and Campylobacter rectus isolates have all previously been shown to carry the ermF gene using Southern blots and dot blots. 12 ,26 DNAs from each were used as templates for the ermF PCR assay and gave 466 bp products which hybridized with the pBF4 plasmid probe (data not shown). The sensitivity of the ermF PCR assay was determined using plasmid pBF4 and chromo somal DNA from S. dysgalactiae. A serial dilution of the DNAs was used as template. The lower limit of detection of a visible PCR product with pBF4 was 100 pg, while for S. dysgalactiae it was 10 ng. The detection was increased ten-fold when Southern blots of PCR products were hybridized with the labelled ermF probe (data not shown).
Presence of the ermF gene in ATCC isolates
We tested 25 Gram-negative ATCC isolates (24 anaerobic and one aerobic) for the presence of ermF. Twenty (80%) of the strains produced ermF PCR products which hybridized with pBF4 (Table I). The 20 ATCC isolates that carried the ermF gene were isolated between 1955 and 1988. Five (25%) (Bacteroides distasonis, Porphyromonas asaccharolytica, Prevotella melaninogenica, Prevotella nigrescens, Prevotella oralis) of the 20 isolates carried another erm gene in addition to ermF (Table I). A. actinomycetemcomitans carried ermA, B, C, F and Q genes, whereas B. thetaiotaomicron carried ermA, B, C and F genes. B. ovatus carried ermA, B and F genes. There are no known functional differences between these erm genes.
Presence of the ermF gene in clinical isolates
We screened 183 clinical isolates cultured primarily in the 1980s and 1990s for the presence of the ermF gene. Fifty-four of 100 Gram-negative anaerobes were positive. The ermF gene was found in 22 (76%) of 29 Bacteroides spp. isolates and in 17 (47%) of 36 Prevotella spp. isolates. All the isolates carrying the ermF gene were isolated on appropriate agar plates containing 10 mg/L of erythro mycin, thus confirming the presence of a functional gene. All B. distasonis, B. ovatus and Bacteroides vulgatus tested carried ermF, while other Bacteroides spp. varied in their carriage of the ermF (Table II). Similarly, all Prevotella bivia, Prevotella denticola and P. nigrescens carried ermF, but other Prevotella spp. varied in their carriage (Table II). Among the two species of Gram-negative aerobes, Haemophilus aphrophilus and A. actinomycetemcomitans, six of nine (67%) isolates tested carried the ermF gene. We found that H. aphrophilus and A. actinomycetemcomitans isolates tested carried a variety of different erm genes, including the ermF gene (Table III).
Twenty (56%) of 36 Gram-positive anaerobes, including all nine Peptostreptococcus spp. tested, carried the ermF gene. Twenty-six (67%) of 39 Gram-positive aerobes carried the ermF gene. Of the 15 animal isolates tested (Staphylococcus intermedius, Staphylococcus lentus, Staphylococcus sciuri, Staphylococcus haemolyticus, Streptococcus agalactiae, S. dysgalactiae and Streptococcus uberis), 14 carried the ermF gene. Of 28 Streptococcus and Staphylococcus species from humans and other animals, all but three (Staphylococcus aureus, Staphylococcus sp., and S. uberis) carried the ermF gene. All of the Streptococcus species tested carried at least one other erm gene (ermB, C or Q) in addition to ermF (Table III). We found both ermF and ermC in Actinomyces viscosus, ermF and ermB in C. butyricum, both Gram-positives, and ermF and ermB in two Gram-negative Fusobacterium species (Table II). There were only two anaerobic isolates that carried multiple erm genes: Peptostreptococcus spp. (ermB, C, F) and C. rectus (ermB, C, F, Q) (Table II). We randomly selected 48 clinical isolates and tested the hybridization of the ermF oligonucleotide probe to dot blots of whole genomic DNA from these isolates. The results were the same as those obtained from the PCR assays (data not shown).
Sequencing
For sequencing we chose C. butyricum, S. dysgalactiae, S. dianae and A. actinomycetemcomitans as representatives of Gram-positive anaerobes, Gram-positive aerobes, Gram-negative anaerobes and Gram-negative aerobes, respectively. The PCR product for C. butyricum was 99% homologous over 404 bp with ermF (data not shown). At the amino acid level, the homology was 98% over 134 amino acids (data not shown). The other three PCR product sequences gave similar results (Table IV).
|
Transfer of the ermF gene
We randomly selected nine Gram-negative and seven Gram-positive species from 12 genera as donors for the transfer study (Table V). Eleven (58%) (B. fragilis, B. ovatus, B. vulgatus, Fusobacterium nucleatum, P. bivia, S. dianae, Gardnerella vaginalis, H. aphrophilus) of 19 Gram-negative donors were able to transfer the ermF gene, whereas all nine of the Gram-positive donors transferred the ermF gene (Table V). The transconjugants were resistant to erythromycin, hybridized with both ermF1 and ermF2 oligonucleotide probes, and gave PCR products that hybridized with the ermF plasmid probe (data not shown). The frequencies of transfer were low (108109 per recipient). For the E. faecalis transconjugants the MIC of erythromycin was 128 mg/L, compared with 1 mg/L for the parental E. faecalis. Erythromycin MICs for the H. influenzae transconjugants were 64 mg/L, compared with 1 mg/L for the recipient strain. Each mating was repeated at least twice.
|
We were not able to move the ermF gene from C. rectus to the E. faecalis recipient. However, C. rectus has previously been shown to transfer ermB, ermC and ermQ genes to E. faecalis. 26 In order to test if C. rectus was able to transfer the ermF gene to a Gram-negative recipient, we chose H. influenzae (Rd8) as a recipient and repeated the mating experiment. We were not able to collect viable C. rectus donors after the donor and the recipient were anaerobically mixed together for 48 h, suggesting that C. rectus may not be able to survive in the presence of H. influenzae, and thus we were unable to do the mating.
Presence of ermF ORF1 and rteA/B genes
In order to determine whether a common mobile element was present in the isolates carrying the ermF gene, PCR assays were developed to screen representative Gram-positive and Gram-negative isolates for the presence of the ORF1 region immediately upstream of ermF (the function of ORF1 is unknown), and the rteA/B region over 20 kb downstream of the ermF gene (Figure). Of the 14 ATCC isolates carrying the structural ermF gene tested for the presence of ORF1 region, all were shown to carry the ORF1, and eight (57%) carried the rteA/B genes (Table VI). Of the isolates carrying the mobile ermF gene, 15 (88%) out of 17 anaerobes carried the ORF1 region. One of the exceptions was C. butyricum which was sequenced and shown to have 99% homology with the structural ermF gene (Table IV), yet carried neither ORF1 nor rteA/B. Ten (59%) out of 17 anaerobes had rteA/B, but only two (25%) of eight aerobes had rteA/B. All eight (100%) of the aerobes had ORF1 (Table VII). The isolates that had non-mobile ermF gene (B. ovatus and C. rectus) carried the ORF 1 and rteA/B regions (Tables V and VII). When we tested other isolates carrying ermF where mobility was unknown, 60 (85%) of 71 anaerobes and 24 (62%) of 30 aerobes carried the ORF1, and 12 (52%) of 23 anaerobes also carried rteA/B (data not shown).
|
|
| Discussion |
|---|
|
|
|---|
The ATCC isolates that carry the ermF gene were isolated between 1955 and 1988 (Table I), indicating a long association between ermF and a variety of different species from four genera. Some ATCC isolates carried other erm genes, including ermA, B, C and Q (Table I). However, the ermF gene was the most common among the five erm genes tested (Table I). The ermF gene was first described in Gram-negative anaerobic Bacteroides spp. The G+C content of the ermF gene is 34%, 9 which is different from that of the bacteroides chromosome (42%). 27 This suggests that the ermF gene may have originated from a species other than Bacteroides, such as a Gram-positive bacterium. The finding and expression of the ermF gene in both Gram-negative and in Gram-positive species, as well as its ability to transfer into and out of Gram-positive and Gram-negative donors and recipients (Table V), support this hypothesis.
ermF is one of the three (ermF, ermFS and ermFU) genes in a group of ermF genes sequenced from the B. fragilis group.8 As there is no established nomenclature system for erm genes, each was given a different designation, although they differ by only a few base pairs. 7 Instead of each having a separate name, it would be easier if the various new genes were all named ermF, as is currently done for tetM genes, 28 especially since the ermF PCR products from four different species were almost identical at both DNA and amino acid levels (Table IV).
In Bacteroides spp., the ermF gene is often associated with a conjugative transposon located on the chromosome. 14 The ermF gene hybridized to the chromosomal region in the bacteria in this study (data not shown), and in 20 (71%) of 28 donors examined, ermF could be trans ferred by conjugation. This suggests that ermF is probably associated with conjugative transposons in these species (Table V). The ORF1 region was detected more often than rteA/B genes, which are located over 20 kb away from the structural gene; the presence of both regions (ORF1 and rteA/B) suggests that a variety of bacteria, including some Gram-positive aerobes, may carry related conjugative elements. The rteA/B region is thought to play a role in regulation of transfer, 14 but there was no correlation between rteA/B and ermF mobility.
We found aerobic species carrying one or more erm genes other than the ermF gene. These genes were generally not as easily transferred as the ermF gene to a recipient by conjugation. The ermB gene moved together with the ermF in one isolate, C. butyricum, which did not have ORF1 or the rteA/B region (Tables V and VII).
This study extends the known host range of the ermF gene in bacteria of both human and animal origin and suggests that gene transfer may occur between bacteria of human origin and those of animal origin. It is likely that these bacteria can act as a reservoir for ermF in both humans and other animals, and related conjugative elements (those that carried ORF1, ermF and rteA/B) are found outside of the B. fragilis group. This is of concern, especially in Europe, where tylosin is used as a growth promoter and the linkage between vancomycin resistance and macrolide resistance in enterococci has been described. 29 ,30 Therefore, we are likely to see an increase in the level of carriage of ermF in the future.
| Acknowledgments |
|---|
This study was partially supported by Public Health Service grant DE10913 from the National Institutes of Health. Some strains and partial support for this study were provided by Atrix Co., Fort Collins, CO, USA. Partial support of this study also came from the United States Department of Agriculture USDA/ FAS/ ICD .RSED GM17 and the Bundesministerium für Ernahrung, Landwirtschaft und Forsten. The authors wish to thank Dr Clay Walker (University of Florida) for providing some of the isolates.
| Notes |
|---|
* Corresponding author. Fax:+1-206-543-3873; E-mail: marilynr{at}u.waxhington.edu
| References |
|---|
|
|
|---|
1 . Goldstein, F. W. & Acar, J. F.(1995). Epidemiology of antibiotic resistance in Haemophilus influenzae. Microbial Drug Resistance, 1, 1315.
2 . Heifets, L. B. (1996). Clarithromycin against Mycobacterium avium complex infections. Tubercle and Lung Disease, 77, 1926.
3 . Klein, J. O. (1997). History of macrolide use in pediatrics. Pediatric Infectious Disease Journal, 16, 42731.[Web of Science][Medline]
4 . Gale, E. F., Cundliffe, E., Reynolds, P. E., Richmond, M. H. & Waring, M. J. (eds) (1981). Antibiotic inhibitors of ribosome function. In The Molecular Basis of Antibiotic Actions, 2nd edn, pp. 402547. John Wiley, Chicheser.
5
.
Arthur, M., Brisson-Noel, A. & Courvalin, P.(1987). Origin and evolution of genes specifying resistance to macrolide, lincosamide
and streptogramin antibiotics: data and hypothesis. Journal of Antimicrobial
Chemotherapy, 20, 783802.
6
.
Leclercq, R. & Courvalin, P.(1991).Bacterial resistance to macrolide,
lincosamide, and streptogramin antibiotics by target modification. Antimicrobial
Agents and Chemotherapy, 35, 126772.
7 . Weisblum, B.(1995). Erythromycin resistance by ribosome modification. Antimicrobial Agents and Chemotherapy, 39, 57785.[Web of Science][Medline]
8
.
Rasmussen, J. L., Odelson, D. A. & Macrina, F. L.(1986). Complete nucleotide sequence and transcription of ermF, a
acrolidelincosamidestreptogramin B resistance determinant from Bacteroides fragilis. Journal of Bacteriology, 168, 52333.
9
.
Smith, C. J.(1987). Nucleotide sequence
analysis of Tn4551: use of ermFS operon fusions to detect promoter activity in
Bacteroides fragilis. Journal of Bacteriology, 169, 458996.
10
.
Halula, M. C., Manning, S. & Macrina, F. L.(1991). Nucleotide sequence of ermFUa,
acrolidelincosamidestreptogramin (MLS) resistance gene encoding an RNA
methylase from the conjugal element of Bacteroides fragilis V503. Nucleic
Acids Research, 19, 3453
11
.
Shoemaker, N. B., Barber, R. D. & Salyers, A. A.(1989). Cloning and
characterization of a Bacteroides conjugal tetracyclineerythromycin resistance
element using a shuttle cosmid vector. Journal of Bacteriology, 171, 1294302.
12 . Roberts, M. C. & Brown, M. B.(1994). Macrolidelincosamide resistance determinants in streptococcal species isolated from the bovine mammary gland. Veterinary Microbiology, 40, 25361.[Web of Science][Medline]
13 . Roberts, M. C., Chung, W. O. & Roe, D. E.(1996). Characterization of tetracycline and erythromycin resistance deter minants in Treponema denticola . Antimicrobial Agents and Chemotherapy,40 , 16904.[Abstract]
14
.
Salyers, A. A., Shoemaker, N. B., Stevens, A. M. & Li,
L. Y.(1995). Conjugative transposons: an unusual and diverse set of integrated
gene
transfer elements. Microbiological Reviews, 59, 57990.
15
.
Roberts, M. C., Moncla, B. J. & Hillier, S. L(1991). Characterization of unusual tetracycline-resistant gram-positive bacteria. Antimicrobial Agents and Chemotherapy,35
, 26557.
16
.
Roe, D. E., Weinberg, A. & Roberts, M. C.(1996). Mobile rRNA methylase genes coding for erythromycin resistance in Actinobacillus actinomycetemcomitans. Journal of Antimicrobial
Chemotherapy,37
, 45764.
17
.
Leng, Z., Riley, D. E., Berger, R. E., Krieger, J. N. &
Roberts, M. C. (1997). Distribution and mobility of the tetracycline resistance
determinant tetQ. Journal of Antimicrobial Chemotherapy, 40, 5519.
18 . Roberts, M. C., Pang, Y., Riley, D. E., Hillier, S. L., Berger, R. C. & Krieger, J. N.(1993). Detection of TetM and TetO tetracycline resistance genes by polymerase chain reaction. Molecular and Cellular Probes, 7, 387[Web of Science][Medline]
19
.
Smith, C. J. & Macrina, F. L.(1984).
Large transmissible clindamycin resistance plasmid in Bacteroides ovatus. Journal
of Bacteriology, 158, 73941.
20 . Sutcliffe, J., Grebe, T., Tait-Kamradt, A. & Wondrack, L.(1996). Detection of erythromycin-resistant determinants by PCR. Antimicrobial Agents and Chemotherapy, 40, 256266.[Abstract]
21
.
Rood, J. I. & Cole, S. T.(1991).
Molecular
genetics and pathogenesis of Clostridium perfringens. Microbiological
Reviews, 55, 62148.
22
.
Berryman, D. I. & Rood, J. I.(1989).
Cloning and hybridization analysis of ermP, a
macrolidelincosamidestreptogramin B resistance determinant from Clostridium perfringens. Antimicrobial Agents and Chemotherapy, 33, 134653.
23 . Rinckel, L. A. & Savage, D. C.(1990). Characterization of plasmids and plasmid-borne macrolide resistance from Lacto bacillus sp. strain 100-33. Plasmid, 23,119 25.[Web of Science][Medline]
24
.
Roberts, M. C., Swenson, C. D., Owens, L. M. &
Smith, A. L.(1980). Characterization of chloramphenicol-resistant
Haemophilus influenzae. Antimicrobial Agents and Chemotherapy, 18, 6105.
25
.
Roberts, M. C., Leonard, R. B., Briselden, A.,
Schoenknecht, F. D. & Coyle, M. B.(1992). Characterization of antibiotic-resistant
Corynebacterium striatum strains. Journal of Antimicrobial Chemotherapy, 30,463
74.
26 . Roe, D. E., Weinberg, A. & Roberts, M. C.(1995). Characterization of erythromycin resistance in Campylobacter (Wolinella) rectus. Clinical Infectious Diseases, 20, Suppl. 2,S3701.
27
.
Rasmussen, J. L., Odelson, D. A. & Macrina, F. L.(1987). Complete nucleotide sequence of insertion element IS4351 from Bacteroides fragilis. Journal of Bacteriology,169
, 357380.
28 . Roberts, M. C.(1994). Epidemiology of tetracycline-resistance determinants. Trends in Microbiology, 2, 35357.[Medline]
29 . Quintiliani, R. & Courvalin, P.(1994). Conjugal transfer of the vancomycin resistance determinant vanB between enterococci involves the movement of large genetic elements from chromosome to chromosome. FEMS Microbiology Letters, 119, 35963.[Web of Science][Medline]
30 . Heaton, M. P. & Handwerger, S.(1995). Conjugative mobilization of a vancomycin resistance plasmid by a putative Enterococcus faecium sex pheromone response plasmid. Microbial Drug Resistance, 1, 17783.
31
.
Cato, E. P. & Johnson, J. L.(1976).
Reinstatement of species rank for B. fragilis, B. ovatus, B. distasonis, B. thetaiotaomicron, and B. vulgatus: designation of neotype strains forB.
fragilis (Veillon & Zuber) Castellani & Chalmers and Bacteroides thetaiotaomicron
(Distaso) Castellani & Chalmers. International Journal of Systematic Bacteriology, 26, 23037.
Received 4 March 1998; returned 7 May 1998; revised 17 June 1998; accepted 27 July 1998
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. P Gettig, C. W Crank, and A. H Philbrick Faropenem Medoxomil Ann. Pharmacother., January 1, 2008; 42(1): 80 - 90. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, Z. Yu, F. C. Michel Jr., T. Wittum, and M. Morrison Development and Application of Real-Time PCR Assays for Quantification of erm Genes Conferring Resistance to Macrolides-Lincosamides-Streptogramin B in Livestock Manure and Manure Management Systems Appl. Envir. Microbiol., July 15, 2007; 73(14): 4407 - 4416. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Luna, M. Heiken, K. Judge, C. Ulep, N. Van Kirk, H. Luis, M. Bernardo, J. Leitao, and M. C. Roberts Distribution of mef(A) in Gram-Positive Bacteria from Healthy Portuguese Children Antimicrob. Agents Chemother., August 1, 2002; 46(8): 2513 - 2517. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Culebras, I. Rodriguez-Avial, C. Betriu, M. Redondo, and J. J. Picazo Macrolide and Tetracycline Resistance and Molecular Relationships of Clinical Strains of Streptococcus agalactiae Antimicrob. Agents Chemother., May 1, 2002; 46(5): 1574 - 1576. [Abstract] [Full Text] [PDF] |
||||
![]() |
F.-J. Schmitz, J. Petridou, H. Jagusch, N. Astfalk, S. Scheuring, and S. Schwarz Molecular characterization of ketolide-resistant erm(A)-carrying Staphylococcus aureus isolates selected in vitro by telithromycin, ABT-773, quinupristin and clindamycin J. Antimicrob. Chemother., April 1, 2002; 49(4): 611 - 617. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matsuoka, M. Inoue, Y. Nakajima, and Y. Endo New erm Gene in Staphylococcus aureus Clinical Isolates Antimicrob. Agents Chemother., January 1, 2002; 46(1): 211 - 215. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. C. Fluit, M. R. Visser, and F.-J. Schmitz Molecular Detection of Antimicrobial Resistance Clin. Microbiol. Rev., October 1, 2001; 14(4): 836 - 871. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Chopra and M. Roberts Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance Microbiol. Mol. Biol. Rev., June 1, 2001; 65(2): 232 - 260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Reig, J.-C. Galan, F. Baquero, and J. C. Perez-Diaz Macrolide Resistance in Peptostreptococcus spp. Mediated by ermTR: Possible Source of Macrolide-Lincosamide-Streptogramin B Resistance in Streptococcus pyogenes Antimicrob. Agents Chemother., February 1, 2001; 45(2): 630 - 632. [Abstract] [Full Text] |
||||
![]() |
C. Werckenthin and S. Schwarz Molecular analysis of the translational attenuator of a constitutively expressed erm(A) gene from Staphylococcus intermedius J. Antimicrob. Chemother., November 1, 2000; 46(5): 785 - 788. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. Bebear, H. Renaudin, A. Bryskier, and C. Bebear Comparative Activities of Telithromycin (HMR 3647), Levofloxacin, and Other Antimicrobial Agents against Human Mycoplasmas Antimicrob. Agents Chemother., July 1, 2000; 44(7): 1980 - 1982. [Abstract] [Full Text] |
||||
![]() |
M. C. Roberts, J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppala Nomenclature for Macrolide and Macrolide-Lincosamide-Streptogramin B Resistance Determinants Antimicrob. Agents Chemother., December 1, 1999; 43(12): 2823 - 2830. [Full Text] |
||||
![]() |
W. O. Chung, K. Young, Z. Leng, and M. C. Roberts Mobile elements carrying ermFand tetQ genes in Gram-positive and Gram-negative bacteria J. Antimicrob. Chemother., September 1, 1999; 44(3): 329 - 335. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Werckenthin, S. Schwarz, and H. Westh Structural Alterations in the Translational Attenuator of Constitutively Expressed ermC Genes Antimicrob. Agents Chemother., July 1, 1999; 43(7): 1681 - 1685. [Abstract] [Full Text] |
||||
![]() |
M. C. Roberts, W. O. Chung, D. Roe, M. Xia, C. Marquez, G. Borthagaray, W. L. Whittington, and K. K. Holmes Erythromycin-Resistant Neisseria gonorrhoeae and Oral Commensal Neisseria spp. Carry Known rRNA Methylase Genes Antimicrob. Agents Chemother., June 1, 1999; 43(6): 1367 - 1372. [Abstract] [Full Text] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






